BioABC
Biology · Molecular biology · Bioinformatics

Free online biology andbioinformatics tools

Analyze DNA, RNA, and protein sequences, inspect biological files, and perform everyday laboratory calculations—directly in your browser.

Try

Your data stays in your browser whenever possible.

01 · Available nowv0.1 — 4 tools

Popular tools

Four utilities are live today. Each one runs in the page, takes pasted sequence or a dropped file, and returns numbers you can copy.

02 · Quick-use workspace

Paste a sequence, get an answer

The same engine the tool pages use. Nothing is uploaded — the sequence below is processed by this page.

Workspace — quick sequence operationsRuns in browserv0.1
Operation
Sequence input348 characters
or drop a .fasta / .txt file
Resultreverse complement
Length
300
GC
56.0%
Strand
5'→3'
NGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGT TGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAG CTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGTCGACGGTTAAACCTGGACCATG GCCTAAGCTTCAAGGTACCGATTGCCAAGCTNAGGCCTAAGGATCCGGTTAATGCCACGT TACGCTCAAGGTCAGCCTTGGAACCTGATCGGTACCGCTAACTGTTCCAGAGGGCGCCAT
03 · Explore by category

The catalog

Every category has its own index page. Tools are added to the categories they belong in — nothing is filed twice to look fuller.

04 · Biological file formats

Open and understand biological files

Preview, validate, and learn about common life-science data formats without installing specialized desktop software. FASTA has a viewer today; the rest begin as format reference pages.

Instrument-specific formats are a long-term goal, not a current claim. Support is announced per format, with a validator and a documented parser, when it ships.

05 · Why BioABC
BioABC — operating notesRev 0.1Sheet 01 of 01
01No installationEvery tool is a web page. Nothing to download, compile, or keep updated.
02No account requiredNo sign-up, no paywall, no usage counter. Open the tool and use it.
03Browser-based processingAll four v0.1 tools compute locally. Sequences you paste are not sent to a server.
04Clear resultsCopyable numbers, stated units, and the method written next to the output.
05Built for real workflowsIUPAC ambiguity codes, FASTA headers, soft-masked bases, and large pastes are handled by default.